ID: 905402890_905402904

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 905402890 905402904
Species Human (GRCh38) Human (GRCh38)
Location 1:37716256-37716278 1:37716296-37716318
Sequence CCTGGACACCGAAGTCCTGCCAA CTGCAGAAACAGCTGGGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115} {0: 1, 1: 0, 2: 1, 3: 26, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!