ID: 905412204_905412207

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 905412204 905412207
Species Human (GRCh38) Human (GRCh38)
Location 1:37778458-37778480 1:37778486-37778508
Sequence CCACAAGGAAGCCCAGAGGATCA AGCAAACATACCAAGCTGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 214} {0: 1, 1: 0, 2: 0, 3: 10, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!