ID: 905491610_905491615

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 905491610 905491615
Species Human (GRCh38) Human (GRCh38)
Location 1:38348663-38348685 1:38348707-38348729
Sequence CCTGGTTTTGGTGATAATCCAAG ACTGGCCCTGCCTTAGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 114} {0: 1, 1: 0, 2: 4, 3: 40, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!