ID: 905580884_905580896

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 905580884 905580896
Species Human (GRCh38) Human (GRCh38)
Location 1:39081996-39082018 1:39082024-39082046
Sequence CCCACCCGCGCCGCCCCAGGCTC CGCGCCCCTCCTCCGCCGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 55, 4: 533} {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!