ID: 905591239_905591245

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 905591239 905591245
Species Human (GRCh38) Human (GRCh38)
Location 1:39165949-39165971 1:39166001-39166023
Sequence CCATCTCCTTCCTTCCTTTCATT TTGATAGTCCCTGTCTTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 19, 2: 120, 3: 849, 4: 4200} {0: 1, 1: 0, 2: 1, 3: 14, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!