ID: 905666734_905666742

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 905666734 905666742
Species Human (GRCh38) Human (GRCh38)
Location 1:39767515-39767537 1:39767550-39767572
Sequence CCATCAGCTCTGCTTCTTACCCA CAGGACTCCCTGGCTCCAGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 26, 4: 320} {0: 2, 1: 1, 2: 12, 3: 157, 4: 469}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!