ID: 905668786_905668806

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 905668786 905668806
Species Human (GRCh38) Human (GRCh38)
Location 1:39778093-39778115 1:39778140-39778162
Sequence CCCCTGTGTTTCGGGGCCCCAGA CCCAAGGGTCTCTTGTCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 13, 4: 132} {0: 1, 1: 1, 2: 3, 3: 25, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!