ID: 905708990_905708993

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 905708990 905708993
Species Human (GRCh38) Human (GRCh38)
Location 1:40085045-40085067 1:40085074-40085096
Sequence CCACCTCTTGTGGAGGGCGTGAC CAGGCCCGCCTGCAGTTATCCGG
Strand - +
Off-target summary {0: 1, 1: 181, 2: 127, 3: 52, 4: 116} {0: 4, 1: 36, 2: 89, 3: 131, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!