ID: 905738891_905738901

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 905738891 905738901
Species Human (GRCh38) Human (GRCh38)
Location 1:40352186-40352208 1:40352227-40352249
Sequence CCAAAGTCCATCTGTGGACCCAG CTTTAATGATATTAGGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 231} {0: 1, 1: 0, 2: 1, 3: 18, 4: 224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!