ID: 905739809_905739816

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 905739809 905739816
Species Human (GRCh38) Human (GRCh38)
Location 1:40360645-40360667 1:40360692-40360714
Sequence CCATAGCAACAGCTGTGTGGCCC AAGGAGAGCACAGTGATTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 177} {0: 4, 1: 34, 2: 84, 3: 158, 4: 457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!