ID: 905779396_905779400

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 905779396 905779400
Species Human (GRCh38) Human (GRCh38)
Location 1:40694429-40694451 1:40694445-40694467
Sequence CCCTCCCTCATTTTTGTTTACAA TTTACAATAACGTTTCACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 610} {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!