ID: 905819707_905819710

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 905819707 905819710
Species Human (GRCh38) Human (GRCh38)
Location 1:40979945-40979967 1:40979962-40979984
Sequence CCAATCAGGGGCGAGGTGACTCG GACTCGGCGTCCTGCCCAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39} {0: 1, 1: 0, 2: 0, 3: 3, 4: 34}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!