ID: 905824013_905824018

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 905824013 905824018
Species Human (GRCh38) Human (GRCh38)
Location 1:41015824-41015846 1:41015837-41015859
Sequence CCCTTATAGCTTAGCCCTAGGGG GCCCTAGGGGAGCTCTGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 50} {0: 1, 1: 0, 2: 2, 3: 29, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!