ID: 905925229_905925233

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 905925229 905925233
Species Human (GRCh38) Human (GRCh38)
Location 1:41745004-41745026 1:41745033-41745055
Sequence CCAGTCTCAGGATTGTGGTTCTG GTAAGCTCCAGCCAGAACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 144} {0: 1, 1: 0, 2: 1, 3: 11, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!