ID: 905938103_905938116

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 905938103 905938116
Species Human (GRCh38) Human (GRCh38)
Location 1:41840744-41840766 1:41840796-41840818
Sequence CCAGCCAGTCACTGGACGACATA CCAGGCATGCTGGGCTGGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 65} {0: 1, 1: 0, 2: 2, 3: 56, 4: 422}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!