ID: 905950683_905950685

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 905950683 905950685
Species Human (GRCh38) Human (GRCh38)
Location 1:41948057-41948079 1:41948070-41948092
Sequence CCACAAGTAATTGCTCAAACCTA CTCAAACCTATGCTGATTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 139} {0: 1, 1: 0, 2: 4, 3: 29, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!