ID: 905958990_905958996

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 905958990 905958996
Species Human (GRCh38) Human (GRCh38)
Location 1:42027558-42027580 1:42027610-42027632
Sequence CCTCCTTGCTGTTCTTCACACAG GCACTTGCTGAACCCTCTGTAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 18, 3: 156, 4: 1134} {0: 1, 1: 0, 2: 3, 3: 21, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!