ID: 906004660_906004668

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 906004660 906004668
Species Human (GRCh38) Human (GRCh38)
Location 1:42457973-42457995 1:42458017-42458039
Sequence CCAAAAATCAAAACAAAATGAGC AGGTCATTCCAGGTGGAGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 131, 4: 1402} {0: 1, 1: 1, 2: 0, 3: 17, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!