ID: 906095025_906095030

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 906095025 906095030
Species Human (GRCh38) Human (GRCh38)
Location 1:43217065-43217087 1:43217104-43217126
Sequence CCAGGACAAATGGACAAGGGCCA GAGTGTGTGCAGAGGGATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 157} {0: 1, 1: 0, 2: 3, 3: 54, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!