ID: 906144821_906144825

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 906144821 906144825
Species Human (GRCh38) Human (GRCh38)
Location 1:43553716-43553738 1:43553749-43553771
Sequence CCTTTTGGAGGTGGGAGGACAAC CAGGCTCCTGTGTCCTGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 148} {0: 1, 1: 0, 2: 2, 3: 26, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!