ID: 906153047_906153055

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 906153047 906153055
Species Human (GRCh38) Human (GRCh38)
Location 1:43598909-43598931 1:43598923-43598945
Sequence CCCAGGTGCAGCATTGGGTGGTG TGGGTGGTGGTGGGGTGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157} {0: 1, 1: 1, 2: 10, 3: 198, 4: 1338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!