ID: 906196670_906196683

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 906196670 906196683
Species Human (GRCh38) Human (GRCh38)
Location 1:43934232-43934254 1:43934271-43934293
Sequence CCTAGAAGAACAAGGTGCAGGAC GGCTGGTGGATGGGGAGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 174} {0: 1, 1: 0, 2: 8, 3: 137, 4: 990}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!