ID: 906271031_906271037

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 906271031 906271037
Species Human (GRCh38) Human (GRCh38)
Location 1:44478874-44478896 1:44478906-44478928
Sequence CCCCGTGGCTGTTGGTGCACTCC CCTTCCTTTTCTATCATCCTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 84} {0: 1, 1: 1, 2: 2, 3: 29, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!