ID: 906280420_906280427

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 906280420 906280427
Species Human (GRCh38) Human (GRCh38)
Location 1:44549640-44549662 1:44549665-44549687
Sequence CCTTCCTCCTGCTGCTTCTTAAC GGGGACTCCAGTGTGACTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 56, 4: 521} {0: 1, 1: 0, 2: 0, 3: 11, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!