ID: 906298530_906298535

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 906298530 906298535
Species Human (GRCh38) Human (GRCh38)
Location 1:44664035-44664057 1:44664066-44664088
Sequence CCAGCTCCTCAGGGTGCTGAGGC AGCTTAAGCCCAGGAGATCAAGG
Strand - +
Off-target summary {0: 2, 1: 49, 2: 2684, 3: 99084, 4: 207065} {0: 1, 1: 41, 2: 763, 3: 6244, 4: 18030}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!