ID: 906310844_906310849

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 906310844 906310849
Species Human (GRCh38) Human (GRCh38)
Location 1:44753155-44753177 1:44753178-44753200
Sequence CCTGCAGTGGCTGAAATACCATT GAGGATGGTCAGCGAGGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156} {0: 1, 1: 0, 2: 5, 3: 32, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!