ID: 906319272_906319285

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 906319272 906319285
Species Human (GRCh38) Human (GRCh38)
Location 1:44806503-44806525 1:44806534-44806556
Sequence CCAGCATGGAGCCCCGGCGCGAG TGGACCTGGACCTGCCGGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 90} {0: 1, 1: 0, 2: 1, 3: 14, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!