ID: 906329315_906329323

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 906329315 906329323
Species Human (GRCh38) Human (GRCh38)
Location 1:44871487-44871509 1:44871534-44871556
Sequence CCCTTGTCCATCTGCATGTATAG TCTGATTTATATTCTGGTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 145} {0: 1, 1: 0, 2: 2, 3: 16, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!