|
Left Crispr |
Right Crispr |
Crispr ID |
906428564 |
906428568 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:45735342-45735364
|
1:45735395-45735417
|
Sequence |
CCAAAGTGCTGGGATTAAAGGCA |
ATGTTGTTTTTGTAGAAACAAGG |
Strand |
- |
+ |
Off-target summary |
{0: 609, 1: 102346, 2: 241916, 3: 242451, 4: 213620} |
{0: 1, 1: 3, 2: 80, 3: 1413, 4: 16047} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|