ID: 906443614_906443615

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 906443614 906443615
Species Human (GRCh38) Human (GRCh38)
Location 1:45873740-45873762 1:45873784-45873806
Sequence CCTGTTAATATCATCAAGCTGTT ACACATTATTTATAGAATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 140} {0: 1, 1: 0, 2: 2, 3: 74, 4: 644}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!