ID: 906463737_906463747

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 906463737 906463747
Species Human (GRCh38) Human (GRCh38)
Location 1:46057981-46058003 1:46058016-46058038
Sequence CCTCCCATCAAGCCCTGGAGGCC GAGTTTCGTGAGCTGGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 31, 4: 314} {0: 1, 1: 0, 2: 6, 3: 107, 4: 703}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!