ID: 906481753_906481761

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 906481753 906481761
Species Human (GRCh38) Human (GRCh38)
Location 1:46203797-46203819 1:46203813-46203835
Sequence CCATTACTTGTCCCCCAAGAGTG AAGAGTGAGTGGGGTGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 115} {0: 1, 1: 0, 2: 4, 3: 47, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!