ID: 906483331_906483338

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 906483331 906483338
Species Human (GRCh38) Human (GRCh38)
Location 1:46215755-46215777 1:46215786-46215808
Sequence CCAGGTGTAGGTACATGCCTGTA ACTTAGGAGGCTGAGGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 304} {0: 490, 1: 11288, 2: 25645, 3: 77460, 4: 142039}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!