ID: 906490710_906490720

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 906490710 906490720
Species Human (GRCh38) Human (GRCh38)
Location 1:46266425-46266447 1:46266472-46266494
Sequence CCCAGTATGGGGCTGGATGTAGA ATGTAGTTCTTGGAGAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 147} {0: 1, 1: 0, 2: 0, 3: 25, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!