ID: 906493683_906493690

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 906493683 906493690
Species Human (GRCh38) Human (GRCh38)
Location 1:46287554-46287576 1:46287605-46287627
Sequence CCTTCCACCCTCTGCCTGAGAAG ATGCTTTGCTCTAGCCAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 337} {0: 1, 1: 0, 2: 4, 3: 59, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!