ID: 906528156_906528163

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 906528156 906528163
Species Human (GRCh38) Human (GRCh38)
Location 1:46508455-46508477 1:46508490-46508512
Sequence CCTGCCAGGCCTCTGGGCAGAAC GGTTCTCTGGACCAGTGTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 298} {0: 1, 1: 0, 2: 1, 3: 12, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!