ID: 906601882_906601885

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 906601882 906601885
Species Human (GRCh38) Human (GRCh38)
Location 1:47137553-47137575 1:47137586-47137608
Sequence CCCTGCTCATTCTGCTTCTGCTG CAGCTCAGCTCTACCTGCATAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 8, 3: 53, 4: 596} {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!