ID: 906613825_906613830

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 906613825 906613830
Species Human (GRCh38) Human (GRCh38)
Location 1:47221690-47221712 1:47221729-47221751
Sequence CCGAGGTAGAGGAGAAGAGCTAA CACTGCCCATTTTATAGCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 172} {0: 1, 1: 0, 2: 3, 3: 30, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!