ID: 906701873_906701882

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 906701873 906701882
Species Human (GRCh38) Human (GRCh38)
Location 1:47865363-47865385 1:47865401-47865423
Sequence CCACCTCTCGCAGTACTGATTTA CACCCAAACACTGGGATATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 89} {0: 1, 1: 0, 2: 0, 3: 20, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!