ID: 906749663_906749668

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 906749663 906749668
Species Human (GRCh38) Human (GRCh38)
Location 1:48247668-48247690 1:48247715-48247737
Sequence CCCTGAAGAGAATCCAACTCAAC CAGAAGCCCAGAGAGAGCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 130} {0: 1, 1: 1, 2: 4, 3: 69, 4: 564}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!