ID: 906779500_906779502

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 906779500 906779502
Species Human (GRCh38) Human (GRCh38)
Location 1:48559894-48559916 1:48559922-48559944
Sequence CCTGACACACAGTAAACAATGAG ATTTGTTTAATAACTATTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 431} {0: 1, 1: 0, 2: 2, 3: 55, 4: 627}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!