ID: 906794895_906794901

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 906794895 906794901
Species Human (GRCh38) Human (GRCh38)
Location 1:48689041-48689063 1:48689062-48689084
Sequence CCCCGTCTCTACTAAAAATACAA AAAACTTAGCTGGGCTGTGGTGG
Strand - +
Off-target summary {0: 98173, 1: 216399, 2: 153384, 3: 81062, 4: 60801} {0: 2, 1: 15, 2: 130, 3: 490, 4: 1252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!