ID: 906794896_906794902

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 906794896 906794902
Species Human (GRCh38) Human (GRCh38)
Location 1:48689042-48689064 1:48689094-48689116
Sequence CCCGTCTCTACTAAAAATACAAA GCCTGCAATCCCAGCCACTCAGG
Strand - +
Off-target summary {0: 164005, 1: 210050, 2: 126715, 3: 67031, 4: 60843} {0: 45, 1: 2605, 2: 82030, 3: 216545, 4: 249053}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!