ID: 906794897_906794901

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 906794897 906794901
Species Human (GRCh38) Human (GRCh38)
Location 1:48689043-48689065 1:48689062-48689084
Sequence CCGTCTCTACTAAAAATACAAAA AAAACTTAGCTGGGCTGTGGTGG
Strand - +
Off-target summary {0: 194929, 1: 143151, 2: 66814, 3: 37831, 4: 46551} {0: 2, 1: 15, 2: 130, 3: 490, 4: 1252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!