ID: 906817981_906817991

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 906817981 906817991
Species Human (GRCh38) Human (GRCh38)
Location 1:48898947-48898969 1:48898998-48899020
Sequence CCATGGTACCTCCTTACTCTCAG ATTGCGCTGCTTCCTCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 235} {0: 1, 1: 1, 2: 1, 3: 12, 4: 121}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!