ID: 906827172_906827179

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 906827172 906827179
Species Human (GRCh38) Human (GRCh38)
Location 1:48993804-48993826 1:48993843-48993865
Sequence CCCACAATCACTGCACTCTCCCT TTTCACATGATGCCAGGAGAAGG
Strand - +
Off-target summary {0: 16, 1: 45, 2: 113, 3: 186, 4: 416} {0: 1, 1: 0, 2: 3, 3: 41, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!