ID: 906879674_906879680

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 906879674 906879680
Species Human (GRCh38) Human (GRCh38)
Location 1:49576460-49576482 1:49576509-49576531
Sequence CCTGCCATTTTCTGCACATAACT GGCTTGTTACTGGGCTTTGGTGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 209, 3: 205, 4: 334} {0: 4, 1: 155, 2: 168, 3: 88, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!