ID: 906910919_906910921

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 906910919 906910921
Species Human (GRCh38) Human (GRCh38)
Location 1:49949388-49949410 1:49949410-49949432
Sequence CCATGGCAAAAGGAACAGTCAGC CAGAGTAAACAGAATGCTGTGGG
Strand - +
Off-target summary {0: 3, 1: 9, 2: 8, 3: 14, 4: 175} {0: 1, 1: 1, 2: 1, 3: 25, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!