ID: 906968851_906968854

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 906968851 906968854
Species Human (GRCh38) Human (GRCh38)
Location 1:50489162-50489184 1:50489187-50489209
Sequence CCTAGACAGGCTGTATATTCCCT AAGATGTAATATCTTCTTATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 131} {0: 1, 1: 0, 2: 1, 3: 40, 4: 301}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!