ID: 906988565_906988576

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 906988565 906988576
Species Human (GRCh38) Human (GRCh38)
Location 1:50713044-50713066 1:50713074-50713096
Sequence CCCAGCTACAGGAGGCTGAGGTG CTCTTGAGGATAGAAGGGGGAGG
Strand - +
Off-target summary {0: 16, 1: 30, 2: 124, 3: 296, 4: 733} {0: 1, 1: 0, 2: 0, 3: 18, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!